COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.
Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.
The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.
D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.
The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.
If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.
In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.
Identification of What Exactly?
The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.
The WHO’s Laboratory testing guidance states:
“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”
The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.
In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:
“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”
These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.
Yet the WHO also state:
“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”
The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)
However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.
Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.
When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.
Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:
“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”
The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.
It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?
Voyage Of Discovery
The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).
All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.
The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.
They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.
The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.
In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.
They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”
Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:
“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”
Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.
This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.
The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.
Isolate Nothing
Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.
Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.
In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:
“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”
This explains why the Australian government state:
“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”
In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:
“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”
To date they have not received a reply.
Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:
“PHE can confirm it does not hold information in the way suggested by your request.”
Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:
“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”
In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:
“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”
Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.
We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.
Testing For Nothing
The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
- RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
- S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
- E gene (Orf1ab) – small membrane protein used in viral assembly
- N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.
The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.
The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.
However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.
Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.
Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.
So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:
Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.
This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.
Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.
This is entirely in keeping with WHO’s test guidelines. They state:
“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”
Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.
The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.
RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)
For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.
No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.
If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.
This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.
Conclusive Fraud
Fraud is a criminal act. The legal definition of fraud is:
“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”
The Legal definition of a conspiracy is:
“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”
It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.
For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.
It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .
Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.
Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.
To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.
These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.
There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.
In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.
Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.


















Iain
I think this is your best work yet. It would be great to get confirmation from Carl Heneghan if possible but don’t think he can dispute your evidence. Very well done. I hope it gets the recognition it deserves. I will share widely and pray it ends this madness.
Thanks Tricia. Much appreciated.
“despite there immeasurable resources” should read “despite their immeasurable resources”. Great well researched article ty so much.
Thanks kindredspirits. Appreciate the proof reading and I encourage all readers to point out all errors. Spelling, punctuation, factual or whatever. I’m a one man band with no editor so I welcome all the help I can get.
What happened to Sweden?
And why have you fallen silent about Sweden?
Never mind, rhetorical question
My god, what did I say wrong?
Hi Peter. As you know I approve all comments to filter out personal attacks (which sadly are common). I don’t know what has happened in Sweden. There doesn’t appear to be any evidence of a second wave there either. Just like there isn’t in the UK.
However, they do now seem to be complying with the Great Reset policies. I note Anders Tegnell has been sidelined. Strange don’t you think, that the evidence base from Sweden changes with a switch of political appointment? Perhaps you can explain to me why that would be the case?
Good morning Iain,
Very good work.
Please address a copy to President Trump with the suggestion to create a new federal crime punishable by death: to manufacture, distribute, administer or give any vaccines to anyone in the US.
This ought to make America great again.
Thanks Jean-Franciois. I won’t for two reasons. Firstly I don’t see political leaders like Trump as important. They are just middle men an women in my view. Puppets for the parasite class. More importantly I can’t because I reject absolutely the notion of capital punishment. However I know the likes of Trump don’t so please feel free to forward this to him if you think it will help.
Iain, I value your hard work. I read widely on the internet, many “conspiracy” writers have their heart in the right place but lack the grammatical ability and incisive logic to pursue their investigatopns, also to document the trail of evidence to the conclusion. Keep it up.
Thanks Paul. Will do.
Very impressive analysis Lain. Outstanding. I’ll circle back to review all your articles. I already knew there was a problem years ago. How do we make it better?
I think we do so by decentralising and building new alternative systems to the one forced upon us by the State.
Sterling work once again Sir!
Keep on keeping on…
Will do mate.
Excellent, I’ll pass this on, thanks.
Many thanks.
Although much, admittedly most, of the scientific evidence and explanations are beyond my apparently dumbed down brain to comperhend, your thoroughly researched excellent article has brought tears to my eyes for the potential even I can see that it has as a highly relevant and realistic contributor to ending this torture we are all being subjected to, and bringing all those responsible and complicit in this fraud and crime against humanity to account. I whole heartedly applaud and thank you for your hard work.
I’m glad you find it useful Viv. Like you, I do not fully understand every nuance of extremely complicated scientific disciplines like genetics. I am working my way through it and recording what I find in this blog. You are not, by any meansm “dumbed down.” You have an enquiring mind, there is no other way to find and then read a blog like In this Together. Your opinions are as valid as any “experts” and you have the inalienable right to form and express them, providing they cause no “legitimate” harm.
Is it not remarkable that the risk of dying with the coronavirus mirrors exactly the risk of dying even if the virus did not exist?
I examined the government’s responses to the coronavirus against its professed motivation to save lives by following the science. You might find it interesting: https://viewsandstories.blogspot.com/2020/11/coronavirus-responses-examination-of.html
Thanks Steve. Outstanding article I will share this on social media and recommend everyone reads it. I suggest we can now see what the motivations are. The confluence between Build Back Better and the Great Reset, the global nature of that policy soundbite, the economic, social and political impact of COVID “response” policies all indicate that the motivation was to lay the ground work for the Great Reset (New World Order).
Hi Iain, loved this piece. Thank you.
Does this paper suggest full isolation? It’s a complex field of science and therefore difficult to understand if this has resulted in a full isolated sequencing of SARS CoV2 or if it’s still mixed in with these monkey cells lines…
Sorry, I had not posted the paper!
Here it is: https://www.pnas.org/content/117/13/7001
No. I don’t think so. They are adding deigned enzymes and antibiotics to nutritionally deprived monkey cells then seeing these cells die. Which of course they would because they’ve just starved them to death. What they are not doing is controlled experiments where they add the same nutrition depriving washes to the cells (minus the alleged “virus”) to see what impact that would have. These viral sequences are based upon the WHO protocols which don’t identify anything specific. They assume this is the virus. Then observe what could well be exosomes or anything similar (“cellular poo” as Frances Leader calls it) and then say, look it’s SARS-CoV-2.
Awesome, and terrifying. Thank you very much.
Glad you found it interesting.
Thanks for your response Iain. That’s helpful.
I guess the same assertion is made in these two published papers detailing separate isolation efforts (Wuhan and CDC)?
https://www.nejm.org/doi/full/10.1056/nejmoa2001017
https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article
To help get my head around this, are they able to fully extract the virus/pathogenic genetic material from the cells expressing CPE – ie do they then fully purify the virus? Or, do they sequence the infected cell line and discount the matches in the gene bank that match their cell line and deduce all other sequences are from the SARS CoV2 virus?
As the Koch’s Postulates have not been met (eg infect a human with an isolated pathogen), does that suggest that we can’t, and if so is that because we’ve tried to but no infection was witnessed?
Sorry if I’m making no sense at all Iain.
Thanks, Steve
Thanks Steve. I’m no geneticist, so without doing considerable research myself I can’t answer that with any great certainty. However, from what little I do understand I would say whatever they have left after removing the cellular material, from cultures where they have seen CPE or from manufactured nucleotide sequences, they call a “sample of the isolated virus.” When they reintroduce this isolated virus to other cell lines they expect to see CPE and, if they do, they call that proof of the virus. But here is the problem. All of their tests are based upon the original genome sequence from Wuhan. But what they are testing for using the primers and probes is not specific. It could be anything, the whole original genome could be nothing but so called “junk” DNA.It may well cause CPE, but so could the antibiotics and whatever else is in the genetic mix. It could be a cell pollutant but not a virus. When they observe round vescicles they then say they are virions, but they could be any number of cell excretions as they struggle to survive in the toxic environment cretaed by the enzyme washes and drugs the scientists use to “sterilise” the cell lines. They are not doing negative control studies. So who knows what CPE they may see if they don’t add th so called virus?
Portuguese judge overturns confinement due to the low reliability of PCR.
http://www.dgsi.pt/jtrl.nsf/33182fc732316039802565fa00497eec/79d6ba338dcbe5e28025861f003e7b30?OpenDocument
Thanks Jordi. An important court decision everyone needs to be aware of.
and I forgot:
was the pandemic not declared in 2020? nichts für ungut…
Well spotted. Many thanks.
Hello again! 🙂 I sent this to someone and they’ve raised a point ref the Polish study that you refer to near the beginning. You quote one aspect of their results, that PCR tests detected no viral activity on the underside of the epithelial layer, nor was there any cell damage on that bottom/basal layer,however the study says that there was both extensive cell damage and that the PCR test detected increasing levels of its target material on the *upper or outer* side of the epithelial layers/”skin”. ie that there was evidence of infection, which had not been found before/in other studies because the virus seems to attack/occur only in/on outward facing membrane which previous studies hadn’t provided before. The Polish study doesn’t seem to support your argument, in fact contradicts it, unless I’ve missed something? Whereas the data about non-specificity is very powerful, thank you again.
Many thanks Amtrup. I will look at it again.
I have removed that section as you were right it doesn’t add to the article and could detract from it. However I have looked into the claimed polarised effect of the alleged virus. That is no CPE observed on the basolateral side but some “release” observed on the apical side. I have then looked for an explanation of this polarisation and looked at the HEA cell lines they commonly used in these experiments. It seems what they are seeing is cell death on the apical side but not on the basolateral side. I can find papers that say this is the polarisation effect but, as yet, no rationale to explain why this should be.
Yes, it’s intriguing that the virus apparently occurs/attacks only on the upper/outerfacing side. It reminds me of the way in which cells in a developing embryo differentiate, depending on whether they find themselves on the outside or inside of each of the early “folding” stages during which the originally homogenous cells create the “tubes” which become gut, spinal column, etc. It makes sense that a virus predominantly associated with respiratory and upper gastrointestinal tract activity would appear on just the outward facing membrane layers, as if it needs that environmental context/condition of interface with the outer “world” for replication. I don’t know if the flu virus behaves similarly. And I don’t know if studies have proved that the material detected by the PCR test is responsible for the cell damage ( the process of replication causing cells to “explode” etc ). About the non-specificity of the sequencing data in tests etc I’ve been wondering how they come up with the reports of different strains of it in different countries, populations etc, supposedly according to how it has spread, how many “generations”/mutations it has been through etc. How can they tell the difference between strains of the virus in different places? 😕 My main crisis management of the PCR has been that at more than 25 cycles it detects such tiny amounts of whatever the target material is that it is not measuring cases or real infection but mere “trace”. Apparently we are all carrying trace amounts of many serious disease-viruses all the time. Thank you again for your work. 🙂
PS. That should of course say “my main criticism of the PCR test” *not* “crisis management”! Sorry. Unnoticed autocorrect activity!
You stepped up here Iain. We need your smarts and your voice. I note that your attention was ‘drawn’ to non English sources, where you uncovered info that I had already read about elsewhere (Jon Rappoport). You don’t have to say what or how you came to trust those Spanish sources. I just find it interesting. (Was it a trust thing? I don’t require an answer. I’m just wondering.) They are part of a large group of independent thinkers (scientists, doctors, bloggers, others), many whom are non Spanish. You seem to now be onto them. Only good things can come from that.
Thanks Arby. Happy to answer your question. I first saw the English translation of the D-Salud claims on Twitter. Initially I was intrigued but very skeptical. I went to their site and used Gargoyl translate and then checked out their board and advisory board. The fact that they were so well qualified gave me the initial impetus to take the claim more seriously and look into it. I then followed their guide and did my own BLAST searches to find out if what they were saying was true. It does appear to be the case. These tests aren’t capable of identifying anything specific.
This just posted at Lockdown Sceptics appears to also support this argument; according to Dutch scientist Peter Borger the PCR test is significantly flawed/completely misleading: https://lockdownsceptics.org/2020/11/26/latest-news-205/
Hi Ian,
Thank you for your excellent work… and (not but) I am extremely concern that it does not really matter how much evidence the independent movement can gather, or how many experts counter the official narrative situation will not change. History teaches us that these people are above the law ! I had to disengage from any news as it only made me feel like there is no hope or end to this tyranny !
As we could see from today’s announcement of the great leader Boris Jong Un the fascisto – communist government is doing whatever they want. I just do not get it, how 60 million people can obey so easily. If I would nicked a bottle of Whiskey from the shop I would (highly likely) be prosecuted. Shockingly, these people are committing crimes that can be (at least on the balance of probabilities) proven and yet nothing is happening. Simon Dolan case is going nowhere, Michael O’Bernica prosecution will also probably end in the gutter, and entire nation (and world) is heading into a total catastrophe. It does feel like a war between Good vs Evil !.
Labour is worst than Tories (no, I do not believe in ‘democracy’), but it is hard not to notice that both parties are committing political suicide. Do they know something we don’t? Fuhrer Schwab already warns us about inevitable ‘Cyber – pandemic’ (WTF?!)
I am constantly missing solutions in this war.
I agree with everything you have just said. We cannot use the existing system to achieve change in my view. It is terminally corrupt and appealing to it, as the legal cases you mention are, is futile. It is controlled by the corrupt and if a court ever ruled against them in any meaningful way they would simply ignore it or create a superior court to overrule it. It is tantamount to asking your slave master to treat you a bit less like a slave.
However I urge you not to be despondent, there are solutions and they could be relatively easy to achieve if only people would take individual responsibility. We have to create decentralised system ourselves. I suggest founded on the Rule of Law and the constitution.
For just some idea of what could be possible take a look at “solutions” on the excellent Corbett Report: – https://www.corbettreport.com/?s=solutions
Great work!
I checked the RdRp gene CTCCCTTTGTTGTGTTGT from the WHO primers table and got 100% sequence match (18/18).
But I couldn’t replicate your findings, as I wasn’t able to get the whole sequence matched. I think I got 14/18 nucleotides matched. On the summary page it said 100% match, but if you checked for alignment, you’d probably find that not the whole sequence was considered.
What do you make of it then? It suggests a lack of specificity in the tests to me.
… in the previous post I meant the sequence match with the human genome…
Hi Iain,
An absorbing article.
I am always wary of delving too deep into a science in which I would not be able to handle any contra-arguments.
I follow this chap on twitter https://twitter.com/Kevin_McKernan
I think he has forgotten more about RT-qPCR than we will ever know and is not particularly impressed with the governmental testing.
It might be worthwhile reaching out to him. I can’t get my head around how new viruses are identified 🙁
Thanks Graeme. I know what you mean about stepping onto scientific territory. I am not a scientist so I invite evisceration for my poor grasp of science. But that is no reason not to try in my view. I think it is vital that we retain a critical approach to science and ask questions if we don’t understand. As Einstein alluded to, if the science is well understood it should be easy enough for scientists to explain it in layman’s terms. If we shy away from asking these questions then we are ceding the intellectual battleground to men and women in white coats, giving them the mystical authority of the priest class. I’m not ready to do that yet and am happy to risk scientific ridicule.
Hi Iain, congratulations on a very cogent if not forensic analysis of the greatest crime ever committed!
Given so many official sources are unable/unwilling to provide proof of the isolated SARS-CoV-2 virus, do you have any explanation for the electron-microscope imagery published on the Robert Koch Institute’s website on 08.09.2020? https://www.rki.de/DE/Content/Infekt/NRZ/EM/Aufnahmen/EM_Tab_covid.html?nn=2463800
The only credits given refer in German to the artists who coloured the imagery. However a search resulted in this document dating from 27.03.2020 in English:
https://www.rki.de/DE/Content/Infekt/NRZ/EM/Aktivitaeten/SARS_CoV_2_Diagnostik_EM.pdf?__blob=publicationFile
This appears to be the origin of the uncoloured EM-photos. The text means little to my untrained eye but perhaps you could peruse it and filter out the pseudo-scientific gobbledygook. It appeared in March 2020, so one wonders why more recent imagery is not now available.
Many thanks for your amazing work – you deserve an award!
Regards, VMA
Thanks VMA. The first thing that strikes me (I haven’t read the accompanying paper) is the declaration that these are SARS-CoV-2 virions. They may be, but they could also be exosomes or other types of spiky, round vesicles.
Hi Iain, you deserve more that an award! I’d like to donate but don’t use/don’t trust paypal on principle. I prefer to make a one-off donation via bank transfer. Could you email me your details?
Thanks, VMA
I think that is related (there are interesting developments regarding the PCR matter) :
https://childrenshealthdefense.org/defender/fda-petition-halt-pfizer-vaccine-efficacy/?utm_source=salsa&eType=EmailBlastContent&eId=bbd46709-8e18-4db5-800a-5a0279542b94
Thanks Hannibal. It seems we are at last seeing some real resistance from the scientific and medical community. It is most welcome and not before time. Dr Yeadon and Dr Wodargs similar request to the European regulators is also worth a read.
https://2020news.de/wp-content/uploads/2020/12/Wodarg_Yeadon_EMA_Petition_Pfizer_Trial_FINAL_01DEC2020_EN_unsigned_with_Exhibits.pdf
Yes I think also that the petitioners/trials requester made the things a bit slow and I have trouble to understand why, as it appears that the diagnostics issues with PCR (and even more qPCR) are know from the beginning of this pandemic and even acknowledged by mainstreams medias and Fauci…
About the all cause mortality calculations have you read that (it’s for the US but though…) ? What do you think ?
https://web.archive.org/web/20201122214034/https://www.jhunewsletter.com/article/2020/11/a-closer-look-at-u-s-deaths-due-to-covid-19
https://ricochet.com/834997/covid-deaths-are-real-rebutting-dr-briand/
The tone of Ricochet’s rebuttal is unnecessarily aggressive, accusing Briand of stupidity, claiming high scientific objectivity and then spouting opinion. Why the fixation on who Briand meant by “experts”, when clearly she was referencing the CDC? But the key rebuttal of his rebuttal is that Ricochet completely misrepresents Briand’s claim. She did not say there was no Spike in excess mortality she said:
“there was a significant decrease in deaths due to heart disease. Even more surprising, as seen in the graph below, this sudden decline in deaths is observed for all other causes.”
Meaning the claimed Spike in mortality cannot be wholly attributed to COVID 19 or, as Briand puts it:
“the total decrease in deaths by other causes almost exactly equals the increase in deaths by COVID-19.”
She acknowledge the Spiked increase in deaths from COVID, though Ricochet insists she didn’t, but noted this corresponded to a decrease in deaths from other causes. Clearly suggesting a considerable number of the Spiked increase in deaths was not attributable to COVID. She did not claim, as alleged by Ricochet, that there was no Spiked increase.
Ricochet then does some analysis (using a different average) to demonstrate the presence of the Spike that Briand never denied in the first place. He then says “voila” this proves the Spike exists (again).
Ricochet simply calls all these deaths COVID deaths, completely ignoring the Briand’s key claim. The entire point of Briands work was to point out attribution of cause in that Spike:
“deaths due to heart diseases, respiratory diseases, influenza and pneumonia may instead be re-categorized as being due to COVID-19.”
Ricochet doesn’t even mention this. He simply asserts heart disease mortality are now called COVID and then remarkably asks “why would this be at all surprising?”
He then offers a frankly bizarre explanation:
“We know that Covid mostly kills old people. What about other causes of death? Do you think that other causes of death affect mostly young people?”
This implies that Ricochet believes it perfectly reasonable to call heart disease COVID. He doesn’t explain why he believes this.
Given the corresponding decrease in heart disease deaths, Briand suggests that the claimed Spike in COVID deaths is actually largely attributable to deaths that were not caused by COVID 19.
This begs the question, if these were increased deaths from heart disease and other causes why should this be and why should they correspond to lockdowns? Briand doesn’t ask but, as you know, I do frequently. Briand found this “surprising” because she expects claimed deaths from COVID 19 to actually be from COVID 19 not heart disease.
Ricochet doesn’t find any of this surprising. He simply believes all deaths were from COVID 19 because he was told that by the CDC. He then refuses to consider the implications of Briand’s actual claim, preferring to offers a strawman rebuttal instead.
Briand further shows how this year’s total mortality differs little from the 5 year average. Ricochet response to this is to prove the presence of the 4 week Spike in mortality, that no one denies, by using a 2 year average. I find Ricochet’s rebuttal to be practically meaningless.
Thank you for this analysis and the time you spend on it Ian because frankly there is so much duplicity and far stretched arguments that I lost myself and I think I am not the only one.
Now there are the vaccines issues that we are entering into more or less willingly (less than more I suspect) as the Pfizer and Moderna trials are fully published we will have to look deeply into these material and all the legal aspects that will be imposed regarding the superficial analysis of these we are currently fed by the mainstreams. It will be even trickier.
You have a typo. Your article reads: “Moreover because the forward and perverse primers envelop the sequence to be amplified…” Perverse should be reverse. Other than that, great article!
This link provides the most articulate breakdown of the PCR test I’ve ever read. This is the mic drop of papers on PCR tests. Further, the author of the original WHO PCR paper, Drosten, said during the MERS outbreak that PCR tests were so sensitive that “people who are actually very healthy are included in the reporting statistics.” They’ve known all along PCR tests are a fraud!
https://t.co/DIQfsezGfk?amp=1
Many thank Geoffrey for spotting the typo. And thanks for the informative link.
“Sweden Seeing “Unprecedented” Resignations In Healthcare Amid Second Wave Surge.”
https://www.zerohedge.com/medical/sweden-seeing-unprecedented-resignations-healthcare-amid-covid-hospitalization-surge
Euromomo – Sweden – no excess mortality – https://www.euromomo.eu/graphs-and-maps
Absolutely “SPOT ON” article re this Psychopathic – instituted, wholesale destruction of so much in the World.
How to get this information to the masses?
Thanks Deirdre. Please share as widely as you can. I maintain no intellectual copyright. You can download, print, adapt or do whatever you wish with all the content on ITT. It’s all completely free and all I ask is that I receive an acknowledgement and that any changes to the text are clearly indicated.
Thank you very much for the article. Your discussion about viral isolation is very helpful. It is troubling that the word isolation is used so loosely. I don’t think it is an accident.
You said, “If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.” I agree completely with you that there is no evidence that SARS-CoV-2 exists, but people are dying from something that may be new. Most of the symptoms have a commonality with many known diseases, but when combined with say loss of the sense of smell there seems that there may be a new disease. I do wonder if there isn’t a previously existent disease with the exact same set of symptoms as COVID 19 and so COVID 19 would simple be a bad synonym. But just because SARS-CoV-2 is an illusion doesn’t mean the disease is too.
The same problem exists with HIV and AIDS. For the same reasons as SARS-CoV-2, HIV hasn’t been proven to exist. It has been said that the disease called AIDS is really just an umbrella for many associated pathologies and may not be a single disease in and of itself, but there are some seemingly unique problems that may be unique to a specific disease called AIDS, for instance the occurrence of Kaposi sarcoma. Because it is assumed that HIV causes AIDS and that they both actually exist, they are, in my opinion, not looking for possible cures or means of disease propagation that are not based on the viral model.
Likewise with COVID 19, if it is a disease and if it is not viral, what is causing it and how is it being propagated? Maybe it is simply the result of vitamin D deficiency. People in nursing homes don’t get much solar exposure. Too bad they have us so distracted with worry about a virus that we don’t think about other possibilities. But maybe that is the whole point. They have us so distracted we aren’t paying attention to what they are really doing, which I guess is what you were saying.
Thanks Carl for an excellent, insightful comment. I agree there was a large mortality spike in the spring and people were presenting with a specific set of symptoms. There could be a whole range of causes from lockdowns, to poisoning of some sort, a new disease and so on. There are more questions than answers.
It is possible to create moving entities with nanotechnology. If enough nano particles have been absorbed by the lung tissue, with the right frequencies it may be possible to cause them to self-assemble into an orderly structure that can move around. Inside the lungs, such moving objects can cause enough damage to shut the system down, depriving it from oxygen, such as is the case with a covid attack. This then would not be a “natural” virus, like a flu virus, and it will not be detected with PCR. Note that a covid attack progresses very differently from a flu. I suspect that there is no virus involved in this pandemic, but that nanotechnology is used. Tweak the frequency and the entity’s structure reorders itself – the new “variant.” The “infection rate” exists due to incorrectly lumping any flu-like symptoms under the nomer “covid” also. However, the actual covid attack is purely random, and is not caused by infection. The effects of a random covid attack are quite serious and cause the ICU’s to be flooded in densely populated areas where the occurrence of a random covid attack is higher. The effects of infection by a flu are not serious, but are intentionally and misleadingly attributed to a “minor form of covid” instead of being categorized as “the flu,” which it heretofore always was. To wit, there are no gradations in a real covid attack; there is no progression from a “minor form of covid” – the flu – to a fullfledged covid attack that rapidly causes a person to go into coma and/or death. A person is either suffering from a deadly covid attack that causes a complete shutdown of the system, or a person suffers to a greater or lesser degree from the standard flu that causes standard malaise. They are by no means the same affliction. To lump covid together with the flu is a coverup for what covid really is. It’s really not that farfetched, and it supports the global fraud Ian writes of. And no vaccine will protect anyone from random attacks in a biowar that uses advanced methodologies.
Restaurant owners need to get their lawsuits going against Bill Gates and company,and include their (ex)employees. Say 25 restaurant owners with 20 employees each ask for $50,000 for each employee as compensation to them for lost wages and mental stress from being let go during a scamdemic when jobs are scarce. That’s 25 times 20 times 50,000 equals $25 million. Then add in what the restaurant owners want for lost income (past and future) and stress. Reiner Fuellmich (German and American lawyer filing class action suits) says you can ask for punative damages as well. So let’s make it an even $50 million.
The case needs to show:
* there is no scientific evidence for SARS-COV-2
* the tests promoted by WHO are fraudulent in many other ways as well
* the promoters of the scamdemic have a history of criminality
Evidence from virologist Stefan Lanka, lawyer Robert Kennedy Jr, doctor Andrew
Kaufman, Covid19-Evidence of Global Fraud author Iain Davis, testimony
found on bitchute dot com of scientist Stefano Scoglio before lawyer Reiner
Fuellmich’s Corona Investigative Committee, and others needs to be compiled and
focused for the case. Expect the other side to use disinfo agents with credentials to try to muddy the waters.
I’m hoping to see a feeding frenzy of lawsuits going agianst the identifiable
accomplices (Gates, Trump, Fauci, Drosten, vaccine corporations, etc.). Evidence
discovery rules in the trials should turn up much additional evidence of fraud
that can then be used in criminal proceedings against the villains.
Getting a fair trial is obviously a big if, but if you could I think it’s an easy win. Reiner Fuellmich has prevailed in tort suits against large criminal corporations. Stefan Lanka the German virologist won in the German Supreme Court in 2017, showing that the alleged “measles virus” was based on pseudoscience. An appeals court in Lisbon ruled on Nov 11 in favor of 4 German tourists held in a hotel all summer who had sued the Health Department… It’s possible to win.
Not just restaurant owners. But many small business owners as well. The entire covid fraud has impacted many hardworking and sincere individuals. This lawsuit propoosal spurs hope again, but now it is a matter of getting it started.
By the way, does anyone know what the purpose is of the “test” by inserting a cotton swab deep into the nose (into the fronal cavity, I would presume). In other words, why *so deep* into a person’s head?
Thanks for your informative comments Zonder. It is encouraging to see growing resistance to the willful destruction of businesses. As for the swabs, I am aware of some claims that they go to the pineal gland and all sorts of nefarious purposes have been alleged. However, this is not something I have looked into and unfortunately I can’t offer you anything of substance on the allegations. I would be interested to see any evidence you have on the subject.
Many thanks Zonder
The reason why I was wondering about this method of testing (intranasally, almost like the manner in which cattle are vaccinated) is because I became suspicious that perhaps the “virus” might be purposely introduced, so as to give the covid campaign more weight with extra acute covid attacks.
Furthermore, I was apparently not that far off with the nanoparticle possibility, because Dr. Lorraine Day talks about it convincingly. Dr. Day, in the below link, mentions how the piece of mRNA in the vaccine can be intercalated into the existing RNA for replication into DNA. As a former molecular biologist who collaborated on genetic manipulations of micro-oganisms I know this is true. I am not stating that the mRNA in the vaccine is indeed equipped to do so, but I strongly suspect it is. Why should it not be; it would defeat the purpose. She also mentions in this clip that nanoparticles are introduced into the brain by means of the “covid test.”
Lorraine Day explains the process of covid genetic manipulation of the human DNA very well. (I suggest you skip her intro till second 35 to start hearing the pertinent stuff.)
Lorraine Day on Israeli News:
https://www.bitchute.com/video/b1iXJcgyUAC3/
For more:
http://tapnewswire.com/2020/11/yes-they-can-vaccinate-us-through-nasal-test-swabs-and-target-the-brain/
In terms of her comment of “being controlled by satellite,” do not forget that a payload of enormous proportion (about 6 satellites) with undisclosed content was deposited in the space around our planet by Elon Musk, in May of 2019. Perhaps in preparation of what you have yet to experience? It’s probably not to improve your cellphone reception.
It’s really time to expose the fraud and sue the perpetrators.
Many thanks for your forum Ian
Thank you for the useful information. I look forward to checking it out.
Here’s a link to Reiner Fuellmich’s Corona website giving a summary of how his lawsuits are progressing (in English). As I say I hope others are getting their lawsuits together as well.
https://www.corona-schadensersatzklage.de/newsletter-355-06-01-2021-money-talks-vi-and-the-worldwide-lawsuits/
Thanks Tom
Very good article I will use your evidence I my own article in danish, I am a danish biologist. And agree with your conclusions, this piece of evidence is strong, must have been quite a challenge to put together, thx for doing this.
I do think however that they indeed did release a virus from Wuhan, where they(Wuhan lab, funded by USA) conducted a “gain of function” experiment on corona-virus, but I also believe that the virus lost some of it power after the release. That is why is is near a comedy too see them lock-dpwn the western world for nothing. I also have proff regarding the number of death from Sweden. It is on my facebook, can send it too you if you are interested Iain.
Thanks Carsten. Regarding gain of function and the links between U.S. funded research and the Wuhan lab, I do think there is a lot of evidence to explore there but it is not something I have done. I would very much like to see your research. Please do drop a link or two.
It’s taken me a couple weeks to read and then re-read I like to ensure I’ve digested every single morsel.
A previous comment asks about nasal swabs – there’s an informative piece on UK Column this week:
3 Feb 2021.
Thanks Poppy
Great work, super interesting. Have you looked into Bill Gates motives for keeping people locked down for the sake of C)2 emissions? He’s now the biggest landowner in the US and presumably he’s out to keep CO2 emissions low by switching to a meatless society.
Thanks Pi Yes, personally I don’t think keeping Co2 down is a concern for Bill. Convincing us that we should be concerned is more to the point, as is having complete control of the food supply and energy market. Not him alone obviously, but the DAVOS clique are certainly making an bid to seize the upper hand in the Agenda 2030 game.
Ingredients of Comirnaty (vaccin) – produced by BioNTech/Pfizer
I recently discovered something interesting. It’s about something I also mentioned in the book that I wrote more than ten years ago. Currently, the effort is well underway to disconnect the human from the natural energy that is received by the pineapple gland, and – I suppose – to replace it by artificial energy via the many satellites that are being placed around the earth. Reason why? Boredom or so, or too much money and they dont know what to do with it anymore? But whatever the reason may be, if you can make artificial intelligence, why not experiment with it on humans, so that you can control them…. I think we have arrived at this point.
Apparently, the ingredients in the corona “vaccine” cause a certain process to be inhibited. If you stimulate the S-antigen, you cause “darkness” in the system (less light is received that is used by the eyes), but this darkness is really a blocked reception of the natural energy that comes from the surrounding layers, like the ionosphere, which energy is required for the human system to vibrate at the proper frequency to function and, most importantly, think properly. I myself call it the God energy, the divine energy that is the driving force for everything that lives. (This has nothing to do with prescribed religion, but purely with my origin being in God and my final return also to God: the neutral and all-encompassing source and driving force behind existence.) The pineapple gland has to do with the reception of this driving energy.
When you have a chance, check out the below scientific links. I have included link excerpts that are short and not that hard to understand, and i think this information is a very important clue as to what is going on in our world nowadays. In fact, the entire global corona sweep is a giant experiment that aims to control humanity from satellites, with manmade vibrations. It all goes hand in hand with the efforts to make a “third dna strand” using nanotechnology that are funded by the US military, plus the many satellites that are crashing thru the roof (causing “global warming”) and the increasing effort to make everything artificial – including future humans.
After all, what’s left to do, now that everything is conquered on earth, and wars are no longer interesting… It’s no different from what prior rulers used to do to obtain world dominance, except that execution is now on a global scale, with the use of technology and science.
1.
https://www.ncbi.nlm.nih.gov/books/NBK567793/
Mechanism of Action
mRNA Vaccines
The mRNA class of vaccines’ rapid evolution and advancements are from the mRNA capabilities to imitate the antigen structure and expression comparable to those occurring during the SARS-CoV-2 infection.[19] The mRNA class of the vaccine does not pose a risk of infection or insertional mutagenesis. The mRNA eludes the anti-vector immunity permitting repeated vaccinations. The mRNA’s ability to produce an undesired immune response within the body can be reduced, and modifications can be arranged to improve the mRNA vaccines’ determination.[20]
Tozinameran (BNT162b2)
The tozinameran (BNT162b2) is a nucleoside-modified messenger RNA (modRNA) expressed in lipid nanoparticles (LNP), encoding the spike (S) protein for the SARS-CoV-2 virus – the main site for neutralizing antibodies.[26][27] The lipid particles allow the transfer of the RNA into host cells, resulting in the SARS-CoV-2 S antigens’ expression.[19] The immunogenicity and antibody response to SARS-CoV-2 S antigens further confers protection against COVID-19.
mRNA-1273 SARS-CoV-2
The mRNA-1273 vaccine comprises of a lipid nanoparticle (LNP) encapsulating nucleoside-modified messenger RNA (modRNA), encoding the perfusion stabilized spike (S) protein of the SARS-CoV-2 virus and an S1-S2 cleavage site, which includes a transmembrane component. The S-2P antigen present on its surface allows entrance into the host cell. This further transfers the RNA into host cells, resulting in the expression of the SARS-CoV-2 S antigens. The immunogenicity and antibody response to SARS-CoV-2 S antigens also confers protection against COVID-19.[27][19]
2.
https://www.ema.europa.eu/en/documents/product-information/comirnaty-epar-product-information_en.pdf
Mechanism of action The nucleoside-modified messenger RNA in Comirnaty is formulated in lipid nanoparticles, which enable delivery of the non replicating RNA into host cells to direct transient expression of the SARS-CoV-2 S antigen. The mRNA codes for membrane-anchored, full-length S with two point mutations within the central helix. Mutation of these two amino acids to proline locks S in an antigenically preferred prefusion conformation. The vaccine elicits both neutralizing antibody and cellular immune responses to the spike (S) antigen, which may contribute to protection against COVID-19.
(author’s note: It says: “may contribute” – and this does not state that there is a statistically significant level of protection, nor does it state that it provides protection at all)
and
3.
https://www.ncbi.nlm.nih.gov/gene/6295
Official Full Name S-antigen visual arrestin provided by HGNC
Primary source HGNC:HGNC:10521
See related Ensembl:ENSG00000130561 MIM:181031
Gene type protein coding
RefSeq status REVIEWED
Organism Homo sapiens
Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo
Also known as RP47; S-AG
Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
Note: SAG (Gene ID: 6295) and RNF7 (Gene ID: 9616) share the SAG symbol/alias in common. SAG is a widely used alternative name for ring finger protein 7 (RNF7), which can be confused with the official symbol for SAG (S-antigen visual arrestin, GeneID 6295). [01 Jun 2018]
Additional:
SAG S-antigen visual arrestin
Gene ID: 6295, updated on 2-Mar-2021
Gene type: protein coding
Also known as: RP47; S-AG
• See all available tests in GTR for this gene
• Go to complete Gene record for SAG
• Go to Variation Viewer for SAG variants
Summary
Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. S-arrestin, also known as S-antigen, is a major soluble photoreceptor protein that is involved in desensitization of the photoactivated transduction cascade. It is expressed in the retina and the pineal gland and inhibits coupling of rhodopsin to transducin in vitro. Additionally, S-arrestin is highly antigenic, and is capable of inducing experimental autoimmune uveoretinitis. Mutations in this gene have been associated with Oguchi disease, a rare autosomal recessive form of night blindness. [provided by RefSeq, Jul 2008]
Many thanks Zonder for a fascinating comment. There certainly a lot to look into there and I will do so.
By all means watch this video. It summarizes the track record and devastation of Bill Gates and his vaccination machinery, since 1998.
https://ourtube.co.uk/watch/UIawpstyY9TbHFv
Many thanks Zonder.
Reason enough for fraud:
https://ourtube.co.uk/watch/5PSwH64ecmUeX52
There is no end to it. How can this be stopped at this point?
Similar GMO’s are in the AstraZeneca jolt. In the Netherlands they have halted the application of this “vaccine” because “many people are getting bloodclots.” A military friend was called not to come and take it tomorrow for this reason. How many people experienced bloodclotting? No news on this yet, but enough to stop the vaccination apparently…
Welke stoffen zitten er in dit middel?
Eén dosis (0,5 ml) bevat:
Chimpansee Adenovirus coderend voor de spike-glycoproteïne ChAdOx1-S van SARS-CoV-2*
, niet minder dan 2,5 × 108 infectieuze eenheden. *
Geproduceerd in genetisch gemodificeerde menselijke embryonale 293-niercellen (human embryonic kidney, HEK) en door recombinant-DNA-technologie.
(produced in human embryonic kidney cells).
Hi, Iain,
while checking out genome sequencing for SARS-Cov2, I came across MN908947.1, 2 & 3. Interestingly the first two reports were called ‘Wuhan Seafood Market pneumonia virus’, while the third was changed to ‘Sars-Cov2 virus’. The latter had an extra gene (Orf10) – the human herpes virus. It would be impossible to create a pandemic from a virus that had been around for ages, but with the addition of the extra gene, WHO could claim it was ‘novel’, and hence a pandemic.
There is much that could be said about this conspiracy, but the one question that does not seem to have been answered is whether this pathogen/micro-organism has been ‘weaponised’, and if so, how? The spread of disease appears to have been targeted, western nations having been hardest hit, especially financially. Poorer, less important nations seem to have avoided the pandemic, although now, after some fifteen months, Papua New Guinea is now succumbing to the ‘disease’ – most likely to allow Australia to continue its gulag policies. As part of the targeting, many countries are being warned of a second or third wave of infection. I would like to say that, in nature, there is no effect without cause. Waves do not happen. They are generated. So, if there is a ‘spike’ in infections (ignoring the reliability of PCR testing), it has most likely been artificially generated. It is also interesting to note that the demographic of infection tends to be in lower socio-economic areas, never, or rarely in rich suburbs, government, or amongst the ‘elite’. Hence the advice that money is the best defence against covid-19.
Finally, although there is a growing awareness of the fraud that is being perpetrated on mankind, this scam has been a long time in the making. One might even say it goes back to Charles Darwin and the theory of evolution, because this in turn permitted acceptance of Louis Pasteur’s ‘Germ Theory’, on which modern medicine is based. Of course this gave rise to the pharmaceutical industry, pills for every complaint, and vaccines. Then, with the introduction of poisons into every day life – fluoridation, chemtrails, etc., – mankind, especially the western world, was softened up for the ‘pandemic’. Undoubtedly, there are other aspects which I haven’t mentioned, but the fact remains that this has been carefully planned, and, unless there were a complete awakening of mankind, there is very little anyone can do about it. Legal action seems to be the best option, but as events in Myanmar show, nothing gets in the way of power grabs. Although very few people believe that this world was created, in spite of the overwhelming mass of evidence, the only way that this scamdemic will be overcome is by the intervention of our Creator. How this will happen, I do not know. But, if it doesn’t, then we are in for a very bleak future.
Thanks Bill for wonderful comment. For me the main issue is that this disease, no matter what the origin, does not even remotely justify the response. I am open minded on the origin but whether designed or exploited clearly the plans to use it as the catalyst for the transformation of the global economy and monetary systems were already in place. The sad thing is there is so much we can do to stop this but it requires collective will, which can only come from awareness of the problem. Just have to keep trying to get the information out.
This is just more nonsense by the part of these fraudsters “virologists”.
On this image the same “virologists” say that the alleged “SARS-CoV-2” particles come from the exterior of the CELL, then enters the CELL and after copying NEW particles are expelled from the interior of CELL to the exterior…
https://i.postimg.cc/7hQd9qZF/alleged-SARS-Co-V-2-cycle.png
and yet they can’t caught all those “viral” particles while in the exterior of the cells!
I am interested in the lack of isolation but am uncertain where the strength of evidence lies. I’ve explored that here if you are interested: – https://www.ukcolumn.org/article/covid-19-hoax
Hello Iain, I had read this article (the version that appeared in OffG) last Nov itself, and then came across this site page of yours a few months back.
Just wanted to say that plz do a follow-up article on this. In the comments you have said you were exploring where the strength of evidence in claims of ‘no virus isolated’ lie. Hope you have arrived at some conclusions by now and will write about it.
I, for one, believe that that the whole field of ‘virology’ is meaningless. They are working on things that don’t exist, which they can never authentically isolate or purify using sound techniques, and of course, they can never ever show that what they claim to be ‘viruses’ are the cause of any ‘disease’ whatsoever.
Hi R Anand. Thanks, I am looking at that now.
I greatly appreciate your work and I fully endorse of what you wrote in this essay. The only thing I have to mention which is not quite correct is the picture/scheme of a coronavirus. The picture shows human coranavirus OC43 (hCoVOC43, which is one of the four “common cold corona viruses”) and not one of the SARS-like viruses. Among human coronaviruses only hCoVOC43 has also got haemagglutinine esterase as a surface protein which it probably inherited through intra-host recombination with an influenza virus. SARS-like coronaviruses only have “spike” (S), “membrane” (M) and “envelope” (E) proteins as surface proteins and not surface haemaglutinin esterase.
Many thanks Wolfgang. I hope other readers will find your comment as informative as I have.